Forsburg lab Protocols: Telomere Length determination
Telomere length can vary from strain to strain and is sensitive to a variety of mutants affecting DNA and chromosome function. This protocol is derived from published work by Julie Cooper and modified by Eliana Gomez in our lab.
Gel Protocol
- Grow cells for ca. 100 generations (we have done it for approx 50 taking into account that they had already been through several generations before we did the experiment).
- Prepare genomic DNA using standard protocols (see Moreno et al; , or the Nurse Lab Handbook).
- Digest gDNA with EcoRI (ApaI is also used but we've had less success with it)
- Run digested DNA on 1 % agarose gel, 1 X TBE.
- Probe with Telomeric oligo probe (5' GGGTTACAGGTTACAGGTTACA 3')
Controls:
- WT strains have a smear between 900 and 1100 bp.
- taz1 strains have really long telomeres, with the smear very much higher
- rhp51 will get slightly longer (above 1100 bp)
- rad2 has slightly shorter telomeres.
Southern blot using oligo probe
- Digest 15ug of genomic DNA overnight.
- Run digested DNA in a 1% agarose 1 x TBE.
- Soak gel in 0.25 N NCl for 10-15 min.
- Rinse gel with dH2O
- Soak gel in 0.4 N NaOH for 30 min
- Wet membrane (I used NEN GeneScreen Plus) with dH2O
- Equilibrate membrane in 0.4 N NaOH for 15 min
- Set up a capillary blot using 0.4 N NaOH (I left transferring for 18 hr)
- Rinse membrane in 2 X SSC
- Cross link DNA to membrane using Stratalinker (you can keep membrane wet at 4°C in sealed bag till hybridization)
- Prehybridize membrane at 42°C with approx 10 ml Prehyb solution (make sure that the membrane is completely covered) for a minimum of 2hrs. You should add the DNASSS (Sonicated salmon sperm DNA) once the Prehyb solution reaches 42°C.
- Before adding the labeled probe change the Prehyb solution for the Hybridization solution. Wait till Hyb Solution reaches to 42°C and add the labeled oligo. Incubate ON at 42°C.
- Wash membrane 2 x with 20 ml 6x SSC/0.1% SDS at room temp.
- I washed membrane again 2 x with 20 ml 6x SSC/0.1% SDS at 50°C. Check radioactivity of membrane with Geiger.
Prehybridizaton solution:
- 6x SSC
- 5x Denhardt's
- 20 mM NaH2PO4
- 500 ug/ml denatured DNASSS (sonicated salmon sperm DNA), boil for 5 min)
Hybridization solution:
- 6x SSC
- 20 mM NaH2PO4
- 0.4 % SDS
- 300 ug/ml denatured DNASSS (boil for 5 min)
Labeling of Oligo probe:
- Telomeric probe: 5' GGGTTACAGGTTACAGGTTACA
- Oligo - 2 ul (100 ng/ul)
- Buffer T4PNK - 5 ul
- ATP-gamma32P - 5 ul
- PNK - 2 ul
- H2O - 36 ul
Incubate at 37*C for 30 min. Stop reaction by adding 5.6 ul of 50 mM EDTA Purify oligo using Bio-Rad Micro Bio-Spin Chromatography columns, Bio-Gel P-6 (Spectrafuge, 1000 xg= 4500 rpm)